≡

HiFiMov

bk opan hindi eslamik song Videos

Did you mean?

Search Results - Showing 12 - 24 Of 45

COCO LEE —Did You Really Love Me— CoCo Lee: Just No Other Way<br/>Artist: CoCo Lee <br/><br/>Written by Jimmy Greco, Ray Contreras<br/>Jimmy G S Publishing admin by WB Music Corp. (ASCAP/Rocy Music (BMI)<br/>Producers: Jimmy Greco and Ray Contreras for Jimmyray Productions<br/>Electric and Acoustic Guitars: Jeff W Smith<br/>Background Vocals: CoCo Lee, Michelle Kelly, Ray Contreras<br/>Keyboards & Drum Programming: Jimmy Greco<br/>Recorded by Peter Moshay at Nutrax Studios, NYC<br/>Guitar: Jeff W Smith<br/>Producer: Jimmy Greco, Ray Contreras<br/>Mixed by Peter Moshay at A-Pawling Studio, Pawling, NY<br/><br/>CoCo Lee: Just No Other Way<br/>BK 03720 <br/>Epic/550 Music<br/>Executive Producer: CoCo Lee <br/>ABR Michael Coplan<br/>Artist Management: Jim and Jason Morey <br/>From Morey Managemen Group MMC<br/>Mastered by Vlado Meller at Sony Studio. NY<br/>Art Direction & design Aimée Moculey<br/>Photography: Torkil Gudnason<br/>Styling: Eric Orlando<br/>hair: Shoy Ashual<br/>Make up: Gionpaola<br/><br/>BK 03720 <br/>CoCo Lee - Just No Other Way <br/>Epic/550 Music<br/><br/>63720<br/><br/>Executive Producer: CoCo Lee<br/><br/>© Sony Music Entertainment (Holland) BV / ℗ Sony Music Entertainment (Holland) BV /Manufactured by Epic/550 Music. A Division Of Sony Music/550 Madison Avenue. New York. HY 10022-3211/\
COCO LEE —Did You Really Love Me— CoCo Lee: Just No Other Way
⏲ 4:1 👁 15K
Khwaja Ajmer Wale
खोले करम का दरवाजा मेरा ख्वाजा मोईनुद्दीन | Khwaja Garib Nawaz Qawwali | Nizami Brothers | Qawwali
⏲ 16 minutes 33 seconds 👁 667.6K
BK sandhya mansia
tu hi tu nazar aaye songBk sapna,brother brejesh mishra
⏲ 8 minutes 20 seconds 👁 4.9M
COCO LEE —Crazy Ridiculous— CoCo Lee: Just No Other Way<br/>Artist: CoCo Lee <br/><br/>Written by Harold Frasier, Steve Clarxe, Nicole Renee, Darnell Cunningham, Roger Romain<br/>EMI Music Publishing/Warner/Chappll Publishing<br/>Produced by The Specialists for Specialists Entertainment, Inc. and Steve Rhythm for Thunderstone Productions, Inc.<br/>Background Vocals: CoCo Lee<br/>All instruments: The Specialists<br/>Rap by DicDasterly<br/>Recorded and Mixed at Sony Studios. New York, NY<br/>Mixed by The Specialists<br/>Mixing Engineer: Jim Janik<br/><br/>CoCo Lee: Just No Other Way<br/>BK 03720 <br/>Epic/550 Music<br/>Executive Producer: CoCo Lee <br/>ABR Michael Coplan<br/>Artist Management: Jim and Jason Morey <br/>From Morey Managemen Group MMC<br/>Mastered by Vlado Meller at Sony Studio. NY<br/>Art Direction & design Aimée Moculey<br/>Photography: Torkil Gudnason<br/>Styling: Eric Orlando<br/>hair: Shoy Ashual<br/>Make up: Gionpaola<br/><br/>BK 03720 <br/>CoCo Lee - Just No Other Way <br/>Epic/550 Music<br/><br/>63720<br/><br/>Executive Producer: CoCo Lee<br/><br/>© Sony Music Entertainment (Holland) BV / ℗ Sony Music Entertainment (Holland) BV /Manufactured by Epic/550 Music. A Division Of Sony Music/550 Madison Avenue. New York. HY 10022-3211/\
COCO LEE —Crazy Ridiculous— CoCo Lee: Just No Other Way
⏲ 3:1 👁 10K
Coke Studio Pakistan
Coke Studio Season 10| Allahu Akbar| Ahmed Jehanzeb & Shafqat Amanat
⏲ 8 minutes 57 seconds 👁 13.7M
malikmshamim
Ya Nazar Mere Peer KI
⏲ 13 minutes 45 seconds 👁 16.7M
COCO LEE —Don't Want My Love— CoCo Lee: Just No Other Way<br/>Artist: CoCo Lee <br/><br/>Written by Aldo Nova<br/>Sony/ATV Songs LLC (BMI) on behalf of Sony/ATV Muic Publishing Canada/ Les Editions Musicale Coporuscio<br/>Produced by Frankie Knuckles for Def Mix Productions<br/>Lead Vocal Produced by Danny Madden & Frankie Knuckles<br/>Vocal Arranger: Frankie Knuckles and Danny Madden<br/>Background Vocals Arranged and Produced by Danny Madden<br/>Background Vocals: Karen Bernad, Stephanie James, James Richards and Nicki Richards<br/>Recorded by David \
COCO LEE —Don't Want My Love— CoCo Lee: Just No Other Way
⏲ 3:50 👁 10K
Coke Studio Pakistan
Coke Studio Season 11| Balaghal Ula Be Kamalihi| Abida Parveen
⏲ 9 minutes 3 seconds 👁 9.1M
Peace of Mind TV
बाबा तेरी कृपा से साँसें मेरी चलती है... | Brahma Kumaris Song
⏲ 9 minutes 2 seconds 👁 8.3M
COCO LEE —I Will Be Your Friend— CoCo Lee: Just No Other Way<br/>Artist: CoCo Lee <br/><br/>Words and Music by Dane Deviller, Sean Hosein, Michelle Lewis<br/>Careers-BMG Music Publishing, Inc (BMI)/Bubalas Publishing/On Board Music/BMG Songs, Inc. (ASCAP)/Wonnabite Music<br/>Produced by Dane Deviller & Sean Hosein for Banana Toons Productions<br/>Arranged and Programme by Dane Deviller and Sean Hosein<br/>Guitars: Dane Deviller<br/>Recorded by Steve (Stu) Smith at Blue Wave Studios in Vancouver, Canada<br/>Assisted by Matt Morteinson<br/>Mixed by Dave Way at Pacifique in Los Angeles, CA<br/><br/>CoCo Lee: Just No Other Way<br/>BK 03720 <br/>Epic/550 Music<br/>Executive Producer: CoCo Lee <br/>ABR Michael Coplan<br/>Artist Management: Jim and Jason Morey <br/>From Morey Managemen Group MMC<br/>Mastered by Vlado Meller at Sony Studio. NY<br/>Art Direction & design Aimée Moculey<br/>Photography: Torkil Gudnason<br/>Styling: Eric Orlando<br/>hair: Shoy Ashual<br/>Make up: Gionpaola<br/><br/>BK 03720 <br/>CoCo Lee - Just No Other Way <br/>Epic/550 Music<br/><br/>63720<br/><br/>Executive Producer: CoCo Lee<br/><br/>© Sony Music Entertainment (Holland) BV / ℗ Sony Music Entertainment (Holland) BV /Manufactured by Epic/550 Music. A Division Of Sony Music/550 Madison Avenue. New York. HY 10022-3211/\
COCO LEE —I Will Be Your Friend— CoCo Lee: Just No Other Way
⏲ 3:28 👁 10K
Heera Gold
New Heart Touching Naat- Rao Ali Hasnain - Haal e Dil - Official Video - Heera Gold
⏲ 6 minutes 2 seconds 👁 45.5M
Bharat Desai-BK Songs
OM Shanti OM - BK Song - Mahendra Kapoor - Om Vyas - Kavi Pradip.
⏲ 6 minutes 11 seconds 👁 2.1M
Pages 2 Of 4
1
2
3
... ...
4
« Previous | Next »

Related Searches

Search Videos

Recent Searches

মেয়েরা কিভাবে হাত মারে | collage ga gp | dolly de remorquage occasion | é | www নতুন বোউয়ের কে বাশর রাতে বিতরে দিলে কেমন লাগেনিয়াম কি বাবে বলে 100 রান এর kajal t | efalghedw s | s8mqid ayre | karnoun doulma | indian bangla range aux com | zulu dance ass | www videos মেয়েদের ছবি | skrita kamera bratislava | sandal jat | মৌসমী photos | dhige bangla song | 02 madokashokto gene split | tap muzic comhaag rath | bangla nokia messenger | www 14মেয়দের com | bangla movie song sabnur rajzgla school girls | ba32 baker act | iron fitness st soupplets | হানিছিগার | sehar ka waqt tha naat | ফটওয়িকা মাহি ছবিকা মাহিয়া মাহি পিকচার | ঠাকুর মা ঝুড়ি কাটুন | crack head outside | tor ak kothi ami thro hagar bajee | prank photo nokia munmun full girl big | ভারতি বাংলা images com জোর করে 3gp video চ | belinda russell weather 2017 | گازیل کشی | riyaj filmww bangla six vido | সাকিব খান বছগিরি ছবি | rangbazz mp3 song | rooftop prince trailer | misbila3crs | loudoun csl center | the layover movie 2017 full movie | তানভীর স্যার | robindro songs hemontoay | দেশি | বাংলা মি বিন ভিডিও | rupsagara moner manus | bangla movie khodar pore ma er sakib and sahara y video পলি ছব | dance moms brookeseason 4 | www হিনদু কোয়েলের মেয়েদের ও | বাংলার ছায়াছবির গান | kolae | bang 15 mpegivideo mpeg 4 | my reaction to a bad thing 82 joseph gaming | iz0pldkcvcs | ggcaccatcatcaagcccaag | meaning of north star | photos video d sabonti full hot বাংলা | definition of moral education | goggles4u uk | jealne by becky g | nagin serial part6 | iexplore exe download | michael panicello | nirvana album | dogs exclusive | ae rascal phone uthao quick gun murugun | the first muvi universor | bangla hakka wap | christiane | reaching banerjee video www com | bts connector | www com baby you | deo com hp line | yoona | sarah nogori dhakar bud | katrina se videos | ছেলেদের সনু দেখাও | indian bangla ma amar movies fast an vide | 1968 dodge dart | বিউটিফুল | নটক বন্ধুবৃও | shakib khan new movies video song | mom beeg com vs sa 1st test in 2015 |
Terms Of Services(TOS)
DMCA Policy
Privacy Policy

©2015-2023 [+]HiFiMov.co (0.00s)